- Gateway® Clone Ordering
- Order Clone Libraries
- Order Custom Clones and Knockouts
- About the Gateway® Process
- Entry Clone Libraries
- Entry Clones
- Knockout Clones
- Forms and Documentation
- Gateway User Survey
2009 H1N1 Influenza A virus Project Status
A checkmark indicates a successful full length clone has been produced and sequence verified.
Click the links for each organism to order
Available Entry Clones
Influenza A Strain |
Clone Type |
PB2 |
PB1 |
PA |
HA |
NP |
NA |
M1 |
M2 |
NS1 |
NS2 |
Total |
CDS |
|
|
|
|
|
|
|
7 |
||||
CDS |
|
|
|
|
|
|
|
|
|
9 |
||
Modified |
|
|
2 |
|||||||||
CDS |
|
|
|
|
4 |
|||||||
CDS |
|
|
|
|
|
|
|
7 |
||||
Modified |
0 |
|||||||||||
Totals: |
29 |
* The HA and NA CDSs were truncated to omit the transmembrane domains.
Available Expression Clones
Influenza A Strain |
Clone Type |
Vector |
PB2 |
PB1 |
PA |
HA* |
NP |
NA** |
M1 |
M2 |
NS1 |
NS2 |
Total |
CDS |
pIVE- LIC- His_cHalo |
|
|
|
|
|
|
6 |
|||||
pFC20A |
|
|
|
3 |
|||||||||
pFC14A |
|
|
|
3 |
|||||||||
CDS |
pIVE- LIC- His_cHalo |
|
1 |
||||||||||
pFC20A |
|
|
|
3 |
|||||||||
pFC14A |
|
|
3 |
||||||||||
Totals: |
18 |
* The HA CDS was truncated to remove the 3' transmembrane domain and tailing sequence.
** The NA CDS was spliced to remove the 5' transmembrane domain and retain the 5' 18bp leader sequence.
- The full annotated CDS(s) for each genomic segment has been cloned (stop codons removed) and sequence verified.
- This table will be updated as more expression clones become verified.
Updated 8/3/09
ABOUT
The PFGRC is making available, at no cost to researchers, sequence validated, cloned open reading frames for use in the study of genes of the novel influenza A (H1N1) virus that was initially detected and identified in April 2009.
The ORFs we have cloned and validated were derived from two clinical isolates A/New York/1669/2009(H1N1) and A/New York/1682/2009(H1N1). We have both Gateway® entry clone constructs available in addition to constructs suitable for direct expression and purification.
CHARACTERISTICS
Gateway® Entry Clones:
- pDONR221 constructs with standard PFGRC att sites appended to include an N-terminal Not I and a C-terminal Mlu I restriction sites. Gateway entry clone constructs are suitable for shuttling into Gateway® compatible destination vectors via LR cloning reactions.
Expression Clones:
Swine Flu constructs based on the Ligation Independent Cloning (LIC) system.
Each pIVE-LIC-His_cHalo clone construct contains an N-terminal 6x His-tag and a C-terminal Halo tag along with both T7 and SP6 promoters and is suitable for expression and purification either In Vitro or in E. coli cells.
- N terminal cloning site (5’-3’) GTGCCGCGCGGCAGCCAC
- C terminal cloning site (5’-3’) AGTGTCGCTCTCGAG
Swine Flu constructs based on Promega’s Flexi® cloning system.
Each open reading frame captured in a pFC20A (Promega catalog #G1681) expression vector contains a C-terminal Halo tag and both T7 and SP6 promoters is suitable for expression and purification either In Vitro or in E. coli cells.
- N terminal cloning site (5’-3’) CACTATAGAATAAGGAGCGATCGCC
- C terminal cloning site (5’-3’) GTTTCTCTCGAGCCAACCACTGAGG
Each open reading frame captured in a pFC14A (Promega catalog #G9651) expression vector contains a C-terminal Halo tag suitable for expression and purification in mammalian cells.
- N terminal cloning site (5’-3’) ACTCACTATAGGGCTAGCGATCGCC
- C terminal cloning site (5’-3’) GTTTCTCTCGAGCCAACCACTGAGG
Format:
All constructs are harbored in DH10B-T1 E. coli cells and shipped as 15% (v/v) glycerol stocks on dry ice. All available clones are accompanied by a sequence validation report and a brief getting started guide.
Related Links: